The recent changes of the social needs to the veterinary fields became a trigger for reorganization or integration of the veterinary departments in public/national universities in Japan. The veterinary medicine has been promoted to raise basic scientists and veterinary practitioners until now. However, in the future, bringing up “social veterinarians” who can work in a veterinary public health, veterinary epidemiology or veterinary risk science has to be encouraged.

View full abstract

The animal health and animal production food safety measures are based on various laws and regulations. Although these measures are drafted in consultation with councils composed of scientists, more epidemiological input is required to ensure they are more scientifically sound, transparent and meet international requirements.

View full abstract

The Ministry of Health, Labour and Welfare (MHLW) maintains the safety of food in Japan by enforcement of the laws relevant to food safety since prevention of foodborne disease is one of important part of public health.
According to the Statistics on Foodbourne Diseases, 1,545 events involved 27,019 cases and 7 deaths were reported in 2005. Meat and poultry meat tend to be contaminated with foodborne pathogens such as entrohaemorragic Escherichia coli (EHEC) and Salmonella spp. To prevent foodborne disease by those foods, collaboration with agricultural sector has been required. Furthermore increase of campylobacteriosis is remarkable during last few years and food implicated to the disease is mainly poultry meat. MHLW promotes to apply HACCP principle for control of foodborne pathogens in poultry processing plant on the assumption that poultry has been contaminated with campylobactor and other foodborne pathogens at poultry farm level. It also promotes to advise public that elderly and youth do not consume undercooked poultry meat.
Food safety administration under MHLW continues to ensure the safety of food in collaboration with other agencies for food production sector.

View full abstract

The Japan Society of Veterinary Epidemiology (JSVE) was established in April 1997. Member of Society is about 450. JSVE published 2 journals per year. From 2007, journal can be read on the web site of J-stage. Annual meeting was held once a year and lecture about the topics related to the epidemiology was also held at least once a year for 10 years. JSVE published the text book of Veterinary Epidemiology, and suggested an ideal curriculum for veterinary students.

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

The objectives of this study were to observe farm productivity measurements and to examine the interrelationships between growth performance measurements and the relationships between reproductive performance and growth performance of pigs on 91 farrow-to-finish swine farms in Japan. Partial correlations analysis was performed using female inventory changes (%) for reproductive performance and market weights for growth performance as controlled variables. In reproductive performance, means of preweaning mortality risks and adjusted 21-day pig weights were 11.3±0.4% and 6.2±0.1kg, respectively. In growth performance, means of days to market, daily gain, and mortality of fattening pigs were 168.7±1.5 days, 0.65±0.01kg, and 5.0±0.3%, respectively. Higher daily gain was correlated with lower mortality of fattening pigs and shorter days to market (P<0.05). Lower preweaning mortality risk and higher adjusted 21-day pig weight in reproductive performance were correlated with higher daily gain and lower mortality of fattening pigs in growth performance (P<0.05). Greater number of pigs weaned per mated female per year was also correlated with higher daily gain and shorter days to market (P<0.05). Mortality of female pigs in breeding herds was not correlated with that of fattening pigs. These results show that higher reproductive performance is related with higher growth performance of pigs on farrow-to-finish swine farms. The adjusted 21-day pig weights and the preweaning mortality risk in breeding herds may be key measurements to link reproductive performance to growth performance.

View full abstract

The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 7 Erysipelothrix reference strains and 13 random primers were tested. Among the tested primers, the primers NK6 (CCCGCGCCCC) and D9355 (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK6 revealed 5 RAPD patterns (a∼e) while primer D9355 revealed 8 RAPD patterns (A∼H) that were not serovar specific. Namely, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar 1a E. rhusiopathiae strains including strain Koganei 65-0.15 for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D9355 is a rapid and reliable method to differentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species.

View full abstract

Since 2004 Bovine Viral Diarrhea Virus (BVDV) control has been launched in some parts of Hokkaido. As the first pioneer, Yubetsu-town implemented control activities in 2002 and started gathering epidemiological information. In this paper, we set up four scenarios to determine which method (either test-and-slaughter or vaccination) was more effective before heifers’ entering to state breeding farms where most infections occur and quantitatively estimated risk of BVDV infection within the town. As results, it is suggested that at least 25∼26 of 100 farms annually get infected with BVDV without any control measurements. Also vaccination only cannot prevent the infection from spreading. If only one of methods is allowed to use, test-and-slaughter is more effective for reducing risk. Furthermore, as the 5th scenario, we quantified risk of purchasing new animals brought from other towns to a market.

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract

[in Japanese]

View full abstract